pJOG317
Properties and application
Synthetic biology
MGLCC accession number
105407
RM350.00
Purified plasmid
Product Information
| Vector backbone | pAGM1301 (Engler et al., 2014) |
| Vector type | Synthetic Biology |
| Bacterial resistance | Spectinomycin |
| Growth temperature | 37°C |
| Host range | DH5alpha |
| Copy number | High Copy |
| Cloning method | Restriction Enzyme |
| 5' cloning site | BpiI (destroyed during cloning) |
| 3' cloning site | BpiI (destroyed during cloning) |
| 5' sequencing primer | CTTTGAGTGAGCTGATACCG |
| 3' sequencing primer | GGGTTCCGCGCACATTTC |
| Cloned gene | 4xmyc tag fused to Twin-Strep tag |
| Species | Synthetic |
| Mutation | BsaI/ BpiI restriction sites removed |
