pAGM16841
Properties and application
Synthetic biology
MGLCC accession number
105416
RM350.00
Purified plasmid
Product Information
| Vector backbone | Level 0 acceptor (Engler et al. 2014) |
| Vector type | Synthetic Biology |
| Bacterial resistance | Spectinomycin |
| Growth temperature | 37°C |
| Host range | DH5alpha |
| Copy number | High Copy |
| Cloning method | Restriction Enzyme |
| 5' cloning site | BpiI (destroyed during cloning) |
| 3' cloning site | BpiI (destroyed during cloning) |
| 5' sequencing primer | CTTTGAGTGAGCTGATACCG |
| 3' sequencing primer | GGGTTCCGCGCACATTTC |
| Cloned gene | STOP codon and nos terminator |
| Species | - |
| Mutation |
