Address
Malaysia Genome and Vaccine Institute, National Institutes of Biotechnology Malaysia, Jalan Bangi, 43000 Kajang, Selangor, Malaysia
Work Hours
Monday to Friday: 830AM - 530PM
pStA0::RBSc33
RM150.00
Purpose / Description: RBS RBSc33 in pStA
Reference: Start-Stop Assembly: a functionally scarless DNA assembly framework optimised for metabolic engineering.
Verification: None
Depositor(s): John Heap
Catalog ID: 114334
Product details
Vector backbone: pGT400
Vector type: Synthetic Biology
Backbone size without insert: 2210 bp
Copy number: High
Growth strain: DH5alpha
Growth temperature: 37°C
Antibiotics Resistance: Ampicillin
Depositor comment: Accession Number MG649442, Alternative ID = pGT331 . Please visit https://www.biorxiv.org/content/early/218/7/4/361626 for bioRxiv preprint.
Gene / Insert: RBS RBSc33
Insert size: 34 bp
Species: Synthetic
Cloning method: Unknown
5′ sequencing primer: OligoGT234 GGGGAAACGCCTGGTATCT
3′ sequencing primer: OligoGT235 AGCAAAAACAGGAAGGCAAA
