Address
Malaysia Genome and Vaccine Institute, National Institutes of Biotechnology Malaysia, Jalan Bangi, 43000 Kajang, Selangor, Malaysia

Work Hours
Monday to Friday: 830AM - 530PM

pJOG822

RM150.00

Purpose / Description: Synthetic biology
Reference: Peripheral infrastructure vectors and an extended set of plant parts for the Modular Cloning system.
Verification: None
Depositor(s): Johannes Stuttmann
Catalog ID: 105430

Product details

Bacteria Resistance: Spectinomycin
Vector backbone: pICH41308 (Engler et al., 2014)
Vector type: Synthetic Biology
Copy number: High
Growth strain: DH5alpha
Growth temperature: 37°C
Antibiotics Resistance: Unknown
Gene / Insert: YFP fused to SV4 Nuclear Localisation Signal
Species: Synthetic
Cloning method: Restriction Enzyme
5′ cloning site: BpiI (destroyed during cloning)
3′ cloning site: BpiI (destroyed during cloning)
Mutation: BsaI/ BpiI restriction sites removed
5′ sequencing primer: CTTTGAGTGAGCTGATACCG
3′ sequencing primer: GGGTTCCGCGCACATTTC