Address
Malaysia Genome and Vaccine Institute, National Institutes of Biotechnology Malaysia, Jalan Bangi, 43000 Kajang, Selangor, Malaysia

Work Hours
Monday to Friday: 830AM - 530PM

pJOG141

RM150.00

Purpose / Description: Synthetic biology
Reference: Peripheral infrastructure vectors and an extended set of plant parts for the Modular Cloning system.
Verification: None
Depositor(s): Johannes Stuttmann
Catalog ID: 105400

Product details

Bacteria Resistance: Spectinomycin
Vector backbone: pAGM1276 (Engler et al., 2014)
Vector type: Synthetic Biology
Copy number: High
Growth strain: DH5alpha
Growth temperature: 37°C
Antibiotics Resistance: Unknown
Gene / Insert: SV4 nuclear localization signal
Cloning method: Restriction Enzyme
5′ cloning site: BpiI (destroyed during cloning)
3′ cloning site: BpiI (destroyed during cloning)
Mutation: TALE-binding site; BsaI/ BpiI restriction sites removed
5′ sequencing primer: CTTTGAGTGAGCTGATACCG
3′ sequencing primer: GGGTTCCGCGCACATTTC