Address
Malaysia Genome and Vaccine Institute, National Institutes of Biotechnology Malaysia, Jalan Bangi, 43000 Kajang, Selangor, Malaysia
Work Hours
Monday to Friday: 830AM - 530PM
pCrU6.4-SpPSY1 / aphVIII
RM150.00
Purpose / Description: Vector for single guide RNA targeting the phytoene synthase gene PSY1 with RNA scaffold for Streptococcus pyogenes Cas9 (SpCas9), controlled by the U6 snRNA promoter #4.
Reference: Targeting of Photoreceptor Genes in Chlamydomonas reinhardtii via Zinc-Finger Nucleases and CRISPR/Cas9
Catalog ID: CC-pPH332
Product details
Vector type: Synthetic Biology, CRISPR
Copy number: Unknown
Growth strain: XL1-Blue
Growth temperature: 37°C
Antibiotics Resistance: Unknown
Gene / Insert: None
Resource information:
Vector for single guide RNA targeting the *phytoene synthase* gene PSY1 with RNA scaffold for *Streptococcus pyogenes* Cas9 (SpCas9), controlled by the U6 snRNA promoter #4. The vector contains an aphVIII cassette for selection on paromomycin.
Target: PSY1 (Cre2.g9592)
Protospacer: GCGCTGGATCTGGCCACGACCG
PAM: NGG
Selection in *C. reinhardtii*: paromomycin
