Address
Malaysia Genome and Vaccine Institute, National Institutes of Biotechnology Malaysia, Jalan Bangi, 43000 Kajang, Selangor, Malaysia
Work Hours
Monday to Friday: 830AM - 530PM
pStA314
RM150.00
Purpose / Description: (Empty Backbone) Start-Stop Assembly Level 314 plasmid
Reference: Start-Stop Assembly: a functionally scarless DNA assembly framework optimised for metabolic engineering.
Verification: None
Depositor(s): John Heap
Catalog ID: 114175
Product details
Vector backbone: pACYC184
Vector type: Synthetic Biology
Backbone size without insert: 3196 bp
Copy number: Low
Growth strain: DH5alpha
Growth temperature: 37°C
Antibiotics Resistance: Chloramphenicol
Depositor comment: Accession Number MG649434, Alternative ID = pGT416. Please visit https://www.biorxiv.org/content/early/218/7/4/361626 for bioRxiv preprint.
Gene / Insert: None
Cloning method: Unknown
5′ sequencing primer: OligoGT486 GATTACGCGCAGACCAAAAC
3′ sequencing primer: OligoGT487 AAACGGTTAGCGCTTCGTTA
